A Genetic Code Game Words

AMINO NAME      ABR.    mRNA    DNA
alanine         Ala a   GCU     CGA
cysteine        Cys c   UGC     ACG
aspartate       Asp d   GAC     CTG
glutamate       Glu e   GAG     CTC
phenylalanine   Phe f   UUU     AAA
glycine         Gly g   GGU     CCA
histidine       His h   CAC     GTG
isoleucine      Ile i   AUC     TAG
lysine          Lys k   AAA     TTT
leucine         Leu l   CUA     GAT
methionine      Met m   AUG     TAC
asparagine      Asn n   AAC     TTG
proline         Pro p   CCC     GGG
glutamine       Gln q   CAA     GTT
arginine        Arg r   CGC     GCG
serine          Ser s   AGC     TCG
threonine       Thr t   ACC     TGG
valine          Val v   GUG     CAC
tryptophan      Trp w   UGG     ACC
tyrosine        Tyr y   UAU     ATA
                stop    UAA     ATT
                stop    UAG     ATC
                stop    UGA     ACT


WORD    DNA strand               DNA strand                WORD

call    TACACGCGAGATGATACT       TACTTGCGATAGGATACT        nail
can     TACACGCGATTGACT          TACTTGCGAGGGACT           nap
cap     TACACGCGAGGGACT          TACTTGCGAATAACT           nay
cat     TACACGCGATGGACT          TACTTGCTCCGATGGACT        neat
dad     TACCTGCGACTGACT          TACTTGCTCTGGACT           net
dead    TACCTGCTCCGACTGACT       TACTTGTAGACGCTCACT        nice
deal    TACCTGCTCCGAGATACT       TACGGGCGATAGTTGACT        pain
deep    TACCTGCTCCTCGGGACT       TACGGGCGATCGTGGACT        past
define  TACCTGCTCAAATAGTTGCTCACT TACGGGCTCTGGACT           pet
dry     TACCTGGCGATAACT          TACGCGCGATTGACT           ran
eat     TACCTCCGATGGACT          TACGCGCGATGGACT           rat
file    TACAAATAGGATCTCACT       TACGCGCGATGGCTCACT        rate
fine    TACAAATAGTTGCTCACT       TACGCGCTCCGACTGACT        read
get     TACCCACTCTGGACT          TACGCGCTCCGAGATACT        real
help    TACGTGCTCGATGGGACT       TACTCGCGACTGACT           sad
hi      TACGTGTAGACT             TACTCGCGATAGGATACT        sail
high    TACGTGTAGCCAGTGACT       TACTCGCGAATATCGACT        says
in      TACTAGTTGACT             TACTCGTTGCGATTTCTCACT     snake
keep    TACTTTCTCCTCGGGACT       TACTGGCTCCGAACT           tea
key     TACTTTCTCATAACT          TACTGGGTGCTCACT           the
lad     TACGATCGACTGACT          TACCACCGATAGTTGACT        vain
lane    TACGATCGATTGCTCACT       TACCACCGAGATTAGCTGACT     valid
late    TACGATCGATGGCTCACT       TACACCTAAACGTTTCTCCTGACT  wicked
lean    TACGATCTCCGATTGACT       TACACCCGAATAACT           way
length  TACGATCTCTTGCCATGGGTGACT TACACCCTCTGGACT           wet
let     TACGATCTCTGGACT          TACATACGAACCTTGACT        yawn
lie     TACGATTAGCTCACT          TACATACTCGATGATACT        yell
like    TACGATTAGTTTCTCACT       TACATACTCTCGACT           yes
live    TACGATTAGCACCTCACT